Review



human brain vascular smooth muscle cells hbvsmcs  (ScienCell)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    ScienCell human brain vascular smooth muscle cells hbvsmcs
    Human Brain Vascular Smooth Muscle Cells Hbvsmcs, supplied by ScienCell, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+brain+vascular+smooth+muscle+cells/human+brain+vascular+smooth+muscle+cells++hbvsmcs++catalog++1100/pm40456777-346-0-7
    Average 90 stars, based on 1 article reviews
    human brain vascular smooth muscle cells hbvsmcs - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Fate erasure logic of gene networks underlying direct neuronal conversion of somatic cells by microRNAs
    Article Snippet: Human Brain Vascular Smooth Muscle Cells , ScienCell Research Laboratories , Cat# 1100.

    Article Title: Synthetic VSMCs induce BBB disruption mediated by MYPT1 in ischemic stroke
    Article Snippet: Human brain vascular smooth muscle cells , ScienCell Research Laboratories , Cat#1100.

    Modification:

    Article Title: GATA2‑miR‑374a axis promotes vascular smooth muscle cells proliferation, migration via targeting circTADA2A/RORA axis
    Article Snippet: .. The Human Brain Vascular Smooth Muscle Cells (HBVSMCs) were bought from Sciencell Research Laboratories, Inc. (cat. no. sc-1100) and the cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), 1% penicillin and 1% streptomycin (Gibco; Thermo Fisher Scientific, Inc.) with an atmosphere of 5% CO 2 at 37 ̊C. ..

    Article Title: Costunolide covalently targets and inhibits CaMKII phosphorylation to reduce ischemia-associated brain damage.
    Article Snippet: Background: Chronic cerebral hypoperfusion (CCH) is a leading cause of disability and mortality worldwide.. Restoring cerebral blood flow (CBF) through vasodilatation is particularly important in the treatment of CCH.. Costunolide (Cos) is a natural sesquiterpenoid compound with vasodilatory effect, but its mechanism is unclear.

    Real-time Polymerase Chain Reaction:

    Article Title: Fate erasure logic of gene networks underlying direct neuronal conversion of somatic cells by microRNAs.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human Astrocytes ScienCell Research Laboratories Cat# 1800 Human Brain Vascular Smooth Muscle Cells ScienCell Research Laboratories Cat# 1100 Human Brain Vascular Pericytes ScienCell Research Laboratories Cat# 1200 Oligonucleotides GAPDH qPCR Forward 50-ATGTTCGTCATGGGTGTGAA -30 This study N/A GAPDH qPCR Reverse 50- TGTGGTCATGAGTCCTTCCA -30 This study N/A MAP2 qPCR Forward 50-CCCTTTGAGAACACGACACA -30 This study N/A MAP2 qPCR Reverse 50-TCTGTTAGCGGTGCTGAGGT -30 This study N/A NCAM2 qPCR Forward 50-AGGGTTGCAGCTGTAAATGG -30 This study N/A NCAM2 qPCR Reverse 50-CATCGTCCTGTTTGGTGATG -30 This study N/A SYT1 qPCR Forward 50-GTGAGCGAGAGTCACCATGA -30 This study N/A SYT1 qPCR Reverse 50-ACGGTGGCAATGGAATTTTA -30 This study N/A P53DD qPCR Forward 50-GCGTAAACGCTTCGAGATGT -30 This study N/A P53DD qPCR Reverse 50-TATGGCGGGAAGTAGACTGG -30 This study N/A Recombinant DNA pMD2.G Addgene 12259 psPAX2 Addgene 12260 pT-BCL-9/9*-124 Addgene 60859 pT-BCL-NS Victor et al.31 N/A LHX3-N174 Abernathy et al.29 N/A ISL1-N174 Abernathy et al.29 N/A rtTA-N144 Addgene 66810 rtTA-p53DD-N144 This study N/A pSLIK-p53DD Addgene 136534 pSynapsin-turboRFP This study N/A Software and algorithms ImageJ Schneider et al.82 https://imagej.nih.gov/ij/ CellProfiler Stirling et al.94 https://cellprofiler.org/ LAS X Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/ p/leica-las-x-ls/ ZEN ZEISS https://www.zeiss.com/microscopy/ us/products/software/zeiss-zen.html Graphpad Prism GraphPad Software Inc http://www.graphpad.com/ Weighted Gene Correlation Network Analysis (WGCNA) Langfelder et al.40 https://cran.r-project.org/web/ packages/WGCNA/index.html RSeQC Wang et al.86 http://code.google.com/p/rseqc/. .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Astrocytes ScienCell Research Laboratories Cat# 1800 Human Brain Vascular Smooth Muscle Cells ScienCell Research Laboratories Cat# 1100 Human Brain Vascular Pericytes ScienCell Research Laboratories Cat# 1200 Oligonucleotides GAPDH qPCR Forward 50-ATGTTCGTCATGGGTGTGAA -30 This study N/A GAPDH qPCR Reverse 50- TGTGGTCATGAGTCCTTCCA -30 This study N/A MAP2 qPCR Forward 50-CCCTTTGAGAACACGACACA -30 This study N/A MAP2 qPCR Reverse 50-TCTGTTAGCGGTGCTGAGGT -30 This study N/A NCAM2 qPCR Forward 50-AGGGTTGCAGCTGTAAATGG -30 This study N/A NCAM2 qPCR Reverse 50-CATCGTCCTGTTTGGTGATG -30 This study N/A SYT1 qPCR Forward 50-GTGAGCGAGAGTCACCATGA -30 This study N/A SYT1 qPCR Reverse 50-ACGGTGGCAATGGAATTTTA -30 This study N/A P53DD qPCR Forward 50-GCGTAAACGCTTCGAGATGT -30 This study N/A P53DD qPCR Reverse 50-TATGGCGGGAAGTAGACTGG -30 This study N/A Recombinant DNA pMD2.G Addgene 12259 psPAX2 Addgene 12260 pT-BCL-9/9*-124 Addgene 60859 pT-BCL-NS Victor et al.31 N/A LHX3-N174 Abernathy et al.29 N/A ISL1-N174 Abernathy et al.29 N/A rtTA-N144 Addgene 66810 rtTA-p53DD-N144 This study N/A pSLIK-p53DD Addgene 136534 pSynapsin-turboRFP This study N/A Software and algorithms ImageJ Schneider et al.82 https://imagej.nih.gov/ij/ CellProfiler Stirling et al.94 https://cellprofiler.org/ LAS X Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/ p/leica-las-x-ls/ ZEN ZEISS https://www.zeiss.com/microscopy/ us/products/software/zeiss-zen.html Graphpad Prism GraphPad Software Inc http://www.graphpad.com/ Weighted Gene Correlation Network Analysis (WGCNA) Langfelder et al.40 https://cran.r-project.org/web/ packages/WGCNA/index.html RSeQC Wang et al.86 http://code.google.com/p/rseqc/. .. REAGENT or RESOURCE SOURCE IDENTIFIER edgeR Robinson et al.87 https://bioconductor.org/packages/ release/bioc/html/edgeR.html ComplexHeatmap Gu et al.90 https://www.bioconductor.org/packages/ devel/bioc/html/ComplexHeatmap.html Integrative Genomics Viewer (IGV) Thorvaldsdóttir et al.93 https://software.broadinstitute.org/ software/igv/download Glimma Ritchie et al.88 https://github.com/Shians/Glimma STAR Dobin et al.83 https://github.com/alexdobin/STAR Salmon Patro et al.85 https://github.com/COMBINE-lab/Salmon Subread:featureCounts Liao et al.84 http://subread.sourceforge.net/ deepTools Ramı́rez et al.92 https://deeptools.readthedocs.io/en/ develop/content/installation.html pCLAMP 10 Software Molecular Devices https://www.moleculardevices.com/ systems/conventional-patch-clamp/ pclamp-10-software

    Recombinant:

    Article Title: Fate erasure logic of gene networks underlying direct neuronal conversion of somatic cells by microRNAs.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human Astrocytes ScienCell Research Laboratories Cat# 1800 Human Brain Vascular Smooth Muscle Cells ScienCell Research Laboratories Cat# 1100 Human Brain Vascular Pericytes ScienCell Research Laboratories Cat# 1200 Oligonucleotides GAPDH qPCR Forward 50-ATGTTCGTCATGGGTGTGAA -30 This study N/A GAPDH qPCR Reverse 50- TGTGGTCATGAGTCCTTCCA -30 This study N/A MAP2 qPCR Forward 50-CCCTTTGAGAACACGACACA -30 This study N/A MAP2 qPCR Reverse 50-TCTGTTAGCGGTGCTGAGGT -30 This study N/A NCAM2 qPCR Forward 50-AGGGTTGCAGCTGTAAATGG -30 This study N/A NCAM2 qPCR Reverse 50-CATCGTCCTGTTTGGTGATG -30 This study N/A SYT1 qPCR Forward 50-GTGAGCGAGAGTCACCATGA -30 This study N/A SYT1 qPCR Reverse 50-ACGGTGGCAATGGAATTTTA -30 This study N/A P53DD qPCR Forward 50-GCGTAAACGCTTCGAGATGT -30 This study N/A P53DD qPCR Reverse 50-TATGGCGGGAAGTAGACTGG -30 This study N/A Recombinant DNA pMD2.G Addgene 12259 psPAX2 Addgene 12260 pT-BCL-9/9*-124 Addgene 60859 pT-BCL-NS Victor et al.31 N/A LHX3-N174 Abernathy et al.29 N/A ISL1-N174 Abernathy et al.29 N/A rtTA-N144 Addgene 66810 rtTA-p53DD-N144 This study N/A pSLIK-p53DD Addgene 136534 pSynapsin-turboRFP This study N/A Software and algorithms ImageJ Schneider et al.82 https://imagej.nih.gov/ij/ CellProfiler Stirling et al.94 https://cellprofiler.org/ LAS X Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/ p/leica-las-x-ls/ ZEN ZEISS https://www.zeiss.com/microscopy/ us/products/software/zeiss-zen.html Graphpad Prism GraphPad Software Inc http://www.graphpad.com/ Weighted Gene Correlation Network Analysis (WGCNA) Langfelder et al.40 https://cran.r-project.org/web/ packages/WGCNA/index.html RSeQC Wang et al.86 http://code.google.com/p/rseqc/. .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Astrocytes ScienCell Research Laboratories Cat# 1800 Human Brain Vascular Smooth Muscle Cells ScienCell Research Laboratories Cat# 1100 Human Brain Vascular Pericytes ScienCell Research Laboratories Cat# 1200 Oligonucleotides GAPDH qPCR Forward 50-ATGTTCGTCATGGGTGTGAA -30 This study N/A GAPDH qPCR Reverse 50- TGTGGTCATGAGTCCTTCCA -30 This study N/A MAP2 qPCR Forward 50-CCCTTTGAGAACACGACACA -30 This study N/A MAP2 qPCR Reverse 50-TCTGTTAGCGGTGCTGAGGT -30 This study N/A NCAM2 qPCR Forward 50-AGGGTTGCAGCTGTAAATGG -30 This study N/A NCAM2 qPCR Reverse 50-CATCGTCCTGTTTGGTGATG -30 This study N/A SYT1 qPCR Forward 50-GTGAGCGAGAGTCACCATGA -30 This study N/A SYT1 qPCR Reverse 50-ACGGTGGCAATGGAATTTTA -30 This study N/A P53DD qPCR Forward 50-GCGTAAACGCTTCGAGATGT -30 This study N/A P53DD qPCR Reverse 50-TATGGCGGGAAGTAGACTGG -30 This study N/A Recombinant DNA pMD2.G Addgene 12259 psPAX2 Addgene 12260 pT-BCL-9/9*-124 Addgene 60859 pT-BCL-NS Victor et al.31 N/A LHX3-N174 Abernathy et al.29 N/A ISL1-N174 Abernathy et al.29 N/A rtTA-N144 Addgene 66810 rtTA-p53DD-N144 This study N/A pSLIK-p53DD Addgene 136534 pSynapsin-turboRFP This study N/A Software and algorithms ImageJ Schneider et al.82 https://imagej.nih.gov/ij/ CellProfiler Stirling et al.94 https://cellprofiler.org/ LAS X Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/ p/leica-las-x-ls/ ZEN ZEISS https://www.zeiss.com/microscopy/ us/products/software/zeiss-zen.html Graphpad Prism GraphPad Software Inc http://www.graphpad.com/ Weighted Gene Correlation Network Analysis (WGCNA) Langfelder et al.40 https://cran.r-project.org/web/ packages/WGCNA/index.html RSeQC Wang et al.86 http://code.google.com/p/rseqc/. .. REAGENT or RESOURCE SOURCE IDENTIFIER edgeR Robinson et al.87 https://bioconductor.org/packages/ release/bioc/html/edgeR.html ComplexHeatmap Gu et al.90 https://www.bioconductor.org/packages/ devel/bioc/html/ComplexHeatmap.html Integrative Genomics Viewer (IGV) Thorvaldsdóttir et al.93 https://software.broadinstitute.org/ software/igv/download Glimma Ritchie et al.88 https://github.com/Shians/Glimma STAR Dobin et al.83 https://github.com/alexdobin/STAR Salmon Patro et al.85 https://github.com/COMBINE-lab/Salmon Subread:featureCounts Liao et al.84 http://subread.sourceforge.net/ deepTools Ramı́rez et al.92 https://deeptools.readthedocs.io/en/ develop/content/installation.html pCLAMP 10 Software Molecular Devices https://www.moleculardevices.com/ systems/conventional-patch-clamp/ pclamp-10-software

    Software:

    Article Title: Fate erasure logic of gene networks underlying direct neuronal conversion of somatic cells by microRNAs.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human Astrocytes ScienCell Research Laboratories Cat# 1800 Human Brain Vascular Smooth Muscle Cells ScienCell Research Laboratories Cat# 1100 Human Brain Vascular Pericytes ScienCell Research Laboratories Cat# 1200 Oligonucleotides GAPDH qPCR Forward 50-ATGTTCGTCATGGGTGTGAA -30 This study N/A GAPDH qPCR Reverse 50- TGTGGTCATGAGTCCTTCCA -30 This study N/A MAP2 qPCR Forward 50-CCCTTTGAGAACACGACACA -30 This study N/A MAP2 qPCR Reverse 50-TCTGTTAGCGGTGCTGAGGT -30 This study N/A NCAM2 qPCR Forward 50-AGGGTTGCAGCTGTAAATGG -30 This study N/A NCAM2 qPCR Reverse 50-CATCGTCCTGTTTGGTGATG -30 This study N/A SYT1 qPCR Forward 50-GTGAGCGAGAGTCACCATGA -30 This study N/A SYT1 qPCR Reverse 50-ACGGTGGCAATGGAATTTTA -30 This study N/A P53DD qPCR Forward 50-GCGTAAACGCTTCGAGATGT -30 This study N/A P53DD qPCR Reverse 50-TATGGCGGGAAGTAGACTGG -30 This study N/A Recombinant DNA pMD2.G Addgene 12259 psPAX2 Addgene 12260 pT-BCL-9/9*-124 Addgene 60859 pT-BCL-NS Victor et al.31 N/A LHX3-N174 Abernathy et al.29 N/A ISL1-N174 Abernathy et al.29 N/A rtTA-N144 Addgene 66810 rtTA-p53DD-N144 This study N/A pSLIK-p53DD Addgene 136534 pSynapsin-turboRFP This study N/A Software and algorithms ImageJ Schneider et al.82 https://imagej.nih.gov/ij/ CellProfiler Stirling et al.94 https://cellprofiler.org/ LAS X Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/ p/leica-las-x-ls/ ZEN ZEISS https://www.zeiss.com/microscopy/ us/products/software/zeiss-zen.html Graphpad Prism GraphPad Software Inc http://www.graphpad.com/ Weighted Gene Correlation Network Analysis (WGCNA) Langfelder et al.40 https://cran.r-project.org/web/ packages/WGCNA/index.html RSeQC Wang et al.86 http://code.google.com/p/rseqc/. .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Astrocytes ScienCell Research Laboratories Cat# 1800 Human Brain Vascular Smooth Muscle Cells ScienCell Research Laboratories Cat# 1100 Human Brain Vascular Pericytes ScienCell Research Laboratories Cat# 1200 Oligonucleotides GAPDH qPCR Forward 50-ATGTTCGTCATGGGTGTGAA -30 This study N/A GAPDH qPCR Reverse 50- TGTGGTCATGAGTCCTTCCA -30 This study N/A MAP2 qPCR Forward 50-CCCTTTGAGAACACGACACA -30 This study N/A MAP2 qPCR Reverse 50-TCTGTTAGCGGTGCTGAGGT -30 This study N/A NCAM2 qPCR Forward 50-AGGGTTGCAGCTGTAAATGG -30 This study N/A NCAM2 qPCR Reverse 50-CATCGTCCTGTTTGGTGATG -30 This study N/A SYT1 qPCR Forward 50-GTGAGCGAGAGTCACCATGA -30 This study N/A SYT1 qPCR Reverse 50-ACGGTGGCAATGGAATTTTA -30 This study N/A P53DD qPCR Forward 50-GCGTAAACGCTTCGAGATGT -30 This study N/A P53DD qPCR Reverse 50-TATGGCGGGAAGTAGACTGG -30 This study N/A Recombinant DNA pMD2.G Addgene 12259 psPAX2 Addgene 12260 pT-BCL-9/9*-124 Addgene 60859 pT-BCL-NS Victor et al.31 N/A LHX3-N174 Abernathy et al.29 N/A ISL1-N174 Abernathy et al.29 N/A rtTA-N144 Addgene 66810 rtTA-p53DD-N144 This study N/A pSLIK-p53DD Addgene 136534 pSynapsin-turboRFP This study N/A Software and algorithms ImageJ Schneider et al.82 https://imagej.nih.gov/ij/ CellProfiler Stirling et al.94 https://cellprofiler.org/ LAS X Leica Microsystems https://www.leica-microsystems.com/ products/microscope-software/ p/leica-las-x-ls/ ZEN ZEISS https://www.zeiss.com/microscopy/ us/products/software/zeiss-zen.html Graphpad Prism GraphPad Software Inc http://www.graphpad.com/ Weighted Gene Correlation Network Analysis (WGCNA) Langfelder et al.40 https://cran.r-project.org/web/ packages/WGCNA/index.html RSeQC Wang et al.86 http://code.google.com/p/rseqc/. .. REAGENT or RESOURCE SOURCE IDENTIFIER edgeR Robinson et al.87 https://bioconductor.org/packages/ release/bioc/html/edgeR.html ComplexHeatmap Gu et al.90 https://www.bioconductor.org/packages/ devel/bioc/html/ComplexHeatmap.html Integrative Genomics Viewer (IGV) Thorvaldsdóttir et al.93 https://software.broadinstitute.org/ software/igv/download Glimma Ritchie et al.88 https://github.com/Shians/Glimma STAR Dobin et al.83 https://github.com/alexdobin/STAR Salmon Patro et al.85 https://github.com/COMBINE-lab/Salmon Subread:featureCounts Liao et al.84 http://subread.sourceforge.net/ deepTools Ramı́rez et al.92 https://deeptools.readthedocs.io/en/ develop/content/installation.html pCLAMP 10 Software Molecular Devices https://www.moleculardevices.com/ systems/conventional-patch-clamp/ pclamp-10-software

    Cell Culture:

    Article Title: Costunolide covalently targets and inhibits CaMKII phosphorylation to reduce ischemia-associated brain damage.
    Article Snippet: Background: Chronic cerebral hypoperfusion (CCH) is a leading cause of disability and mortality worldwide.. Restoring cerebral blood flow (CBF) through vasodilatation is particularly important in the treatment of CCH.. Costunolide (Cos) is a natural sesquiterpenoid compound with vasodilatory effect, but its mechanism is unclear.



    Similar Products

    human vascular smooth muscle cells n vitro  (Innoprot Inc)
    90
    Innoprot Inc human vascular smooth muscle cells n vitro
    Human Vascular Smooth Muscle Cells N Vitro, supplied by Innoprot Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+brain+vascular+smooth+muscle+cells/Human+Brain+Vascular+Smooth+Muscle+Cells/10__1016_slash_j__artere__2024__11__004-31-87-118
    Average 90 stars, based on 1 article reviews
    human vascular smooth muscle cells n vitro - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    human brain vascular smooth muscle cells hbvsmcs  (ScienCell)
    90
    ScienCell human brain vascular smooth muscle cells hbvsmcs
    Human Brain Vascular Smooth Muscle Cells Hbvsmcs, supplied by ScienCell, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+brain+vascular+smooth+muscle+cells/human+brain+vascular+smooth+muscle+cells++hbvsmcs++catalog++1100/pm40456777-346-0-7
    Average 90 stars, based on 1 article reviews
    human brain vascular smooth muscle cells hbvsmcs - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    human brain vascular smooth muscle cells  (ScienCell)
    90
    ScienCell human brain vascular smooth muscle cells
    Human Brain Vascular Smooth Muscle Cells, supplied by ScienCell, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+brain+vascular+smooth+muscle+cells/human+brain+vascular+smooth+muscle+cells/pmc11834941-91-0-7
    Average 90 stars, based on 1 article reviews
    human brain vascular smooth muscle cells - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    human brain vascular smooth muscle cells (hbvsmcs  (ScienCell)
    90
    ScienCell human brain vascular smooth muscle cells (hbvsmcs
    Human Brain Vascular Smooth Muscle Cells (Hbvsmcs, supplied by ScienCell, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+brain+vascular+smooth+muscle+cells/human+brain+vascular+smooth+muscle+cells/pm39841284-68-0-11
    Average 90 stars, based on 1 article reviews
    human brain vascular smooth muscle cells (hbvsmcs - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    human brain vascular smooth muscle cells (hbvsmcs)  (ScienCell)
    90
    ScienCell human brain vascular smooth muscle cells (hbvsmcs)
    Human Brain Vascular Smooth Muscle Cells (Hbvsmcs), supplied by ScienCell, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+brain+vascular+smooth+muscle+cells/human+brain+vascular+smooth+muscle+cells/pm39084350-50-0-22
    Average 90 stars, based on 1 article reviews
    human brain vascular smooth muscle cells (hbvsmcs) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    human brain vascular smooth muscle cells (hbvsmcs; cat. no. cp-h116)  (Procell Inc)
    90
    Procell Inc human brain vascular smooth muscle cells (hbvsmcs; cat. no. cp-h116)
    Human Brain Vascular Smooth Muscle Cells (Hbvsmcs; Cat. No. Cp H116), supplied by Procell Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+brain+vascular+smooth+muscle+cells/human+brain+vsmcs+cp+h116/pm38368567-44-0-13
    Average 90 stars, based on 1 article reviews
    human brain vascular smooth muscle cells (hbvsmcs; cat. no. cp-h116) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results